Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0064
Clone ID AC0064
Vector pGT0lxr
Project sanger

Sequence tag AC0064
Sequence
TTGATCACCTGGCTCTGCTGAATGAGAAGCAGGCAGCCAGCTCCCAGGAGCCCAGTGAGCTTGAGGAGCTCCGAGTCAAG
AATGAAAGCCTCTTCTGTGCGGTCTGCTTTTTTTTTTTAAGCAGTGTCAGAACCTGAAGACCGAGAAGAGCCAGATGGAT
CGAAAGATTAGCCAGCTTTCTGAGGAGAATGGGGACCTTTCCTTTAAG
Sequence Type mRNA
Unitrap ID UNI4697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 109144362..109144654 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066306 (Numa1) NM_133947 nuclear mitotic apparatus protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443665]

 
Come back to gene ENSMUSG00000066306


For any suggestions or comments, please send an email to unitrap@crg.es