Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0061
Clone ID AC0061
Vector pGT0lxr
Project sanger

Sequence tag AC0061
Sequence
TTTTTAAAGGGTTTTTTTTTTTTTTTGACTGATGACTACCATGTTGTCCAATGCAAGNTGCTGGGTCTGGGTGTGAACGG
CAAGGTACTGGAGTGCTACCATCGGCGCTCTGGCCAGAAGTGTGCCCTGAAG
Sequence Type mRNA
Unitrap ID UNI4698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107191451..107191554 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032577 (Mapkapk3) NM_178907 mitogen-activated protein kinase-activated protein kinase 3 Gene [Source:MGI (curated);Acc:Mapkapk3-001]

 
Come back to gene ENSMUSG00000032577


For any suggestions or comments, please send an email to unitrap@crg.es