Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST309944
Clone ID OST309944
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST309944
Sequence
ACTGAGGGGATGCACAGATGTCATTTGCTGTGTGTTGCTCTTCCTGGCCATCGTAGGCTATGTGGCTGTGGGCATCATAG
CCTGGACCCATGGAGACCCTCGGAAGGTGATCTACCCCACTGATAGCCGGGGCGAATTCTGTGGGCAAAAGGGGACAAAA
AATGCGGACAAACCGTTCTTGTTTTACTTCAACATCGTGAAGTGTGCCAACCCCCTGGTCCTGCTGGAATTTCACTGTCC
CACCCCTCAGATCTGCGTGAAGCAGTGTCCAGACCGCTATCTCACCCTTCTGAGTGCGCGCAACACTCGCGACTTTGACT
ATTACAAGCAGTTCTGTGTGCCTGGCTTCCAGAACAATAAAGGGGTGACTGAGATNCTCCGAGATGGGGAGTGTCCAGCG
GTTATCACCCCCAGCAAACCTTTGGCCCAGNNGAGNANTTNCCNNCATACATGCCANNAAAGGNGTTNTCATGGNGGTCN
NTNANACGACCTATGAGGACGGACATGGCAGCCA
Sequence Type mRNA
Unitrap ID UNI22061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21146221..21147276 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057193 (Slc44a2) NM_152808 solute carrier family 44, member 2 Gene [Source:MGI Symbol;Acc:MGI:1915932]

 
Come back to gene ENSMUSG00000057193


For any suggestions or comments, please send an email to unitrap@crg.es