Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST309575
Clone ID OST309575
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST309575
Sequence
TTTTGAGGAAACCGTGGGCCTCGCTTTGGTGAAATCAACGAAAAAGATATTGACTGGGGGAAACGCTGCGTGTTTAAATT
TGATATCATCGGAATTATTGGAGAAGGTACTTATGGACAAGTTTACAAAGCCAGGGACAAAGACACGGGAGAAATGGTAG
CCTTAAAGAAAGTACAGTCTGGATAATGAAAAGGAGGGTTTCCCAATTACAGCATTTAGAGAAATTAAAATTTTTTGGNA
ACTCACCCACCAGAGTATCATCAATATGAAGGAAATCGNGACTGANAAANAANATGCTTTGGATTTTAAGAAAGACAAAG
GTGCATTNNACCTGGNGTTTGAATATATGGACCATGATCTGATGGGACTGCTGGAATCAGGCTTGGTTCATTTTAATGAA
AACCATATAAAATCTTTTATGAGACAGCTCATGGAAGGCCTGGATTATTGTCATAANAAGAACTTTTTNCATAGAGATAT
TAAATGTTCAAATATCCTTCTAAATAATAGAGGAC
Sequence Type mRNA
Unitrap ID UNI22068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 17843505..17856922 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041297 (Cdc2l5) NM_001081058 cell division cycle 2-like 5 (cholinesterase-related cell division controller) Gene [Source:MGI Symbol;Acc:MGI:1916812]

 
Come back to gene ENSMUSG00000041297


For any suggestions or comments, please send an email to unitrap@crg.es