Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST309383
Clone ID OST309383
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST309383
Sequence
ACTGAGATGGTACCGGGCTCCTGAGTTATTGTTTGGAGCTAGGATGTATGGTGTGGGAGTAGACATGTGGGCTGTTGGTT
GTATATTAGCAGAATTGCTTCTAAGGGTTCCATTTTTGCCTGGAGATTCAGATCTTGATCAGCTAACAAGGATATTTGAA
ACTCTGGGTACACCAACTGAAGAGCAGTGGCCTGACATGTGTAGTCTTCCCGATTATGTGACATTTAAGAGTTTCCCTGG
GGTCCCACTGCAGCACATNTTCATCGCGGCTGGGGACGACCTGCTGGAGCTCATCCAAGGCCTGTTCTTATTTAACCCGT
GTACGCGGACCACAGCCTCACAGGCATTGAAGACCAAGTACTTCAGTAACCGCCCCGGGCCAACACCTGGATGCCAGCTC
CCGCGACCAAACTGTCCGGTGGAGGCATTAAAGGAACCGGCGAATCCAACCGTGGCAACAAAGCGGAAAAGAGCAGAGGC
CTTAGAACAAGGAATATTGCCC
Sequence Type mRNA
Unitrap ID UNI15923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101474345..101481556 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069089 (Cdk7) NM_009874 cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase) Gene [Source:MGI Symbol;Acc:MGI:102956]

 
Come back to gene ENSMUSG00000069089


For any suggestions or comments, please send an email to unitrap@crg.es