Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST309351
Clone ID OST309351
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST309351
Sequence
CTGGTCCTATGGTGGCTACCTCTCCCTGANGGCATTAATGCANAGGTCGGATATCTTCCGGGTGGNTATTGNTGAGNCCC
CAGTCACCCTGNGGATCTTNTATGATACAGGATACACGGAGCGCTNTATGGGTCACCNTGACCAGAATGAACAGGGCTAC
TACTTAGGATCTGCGGCCATGCAAGCGGAGAAGTTCCCCTCAGAACCAAACCGGTTACTCCTCTTGCATGGGTTCTTGTA
TGAGAATGTTCACTTTGCACACAC
Sequence Type mRNA
Unitrap ID UNI22077

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64923635..64926540 126
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032393 (Dpp8) NM_028906 dipeptidylpeptidase 8 Gene [Source:MGI Symbol;Acc:MGI:1921638]

 
Come back to gene ENSMUSG00000032393


For any suggestions or comments, please send an email to unitrap@crg.es