Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0124
Clone ID XT0124
Vector pGT0lxf
Project sanger

Sequence tag XT0124
Sequence
CCGTTTCGAGCAGGCTGAAAGCTTGGTCTGATTTGTTTTAATCTCTGCTGCCAGGGGCCTTAGGGAATTGCCAGCGATCT
ACGACGTGGCGACATG
Sequence Type mRNA
Unitrap ID UNI4711

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62568067..62568162 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055228 (8430426H19Rik) NM_178875 RIKEN cDNA 8430426H19 gene Gene [Source:MGI Symbol;Acc:MGI:1918758]

 
Come back to gene ENSMUSG00000055228


For any suggestions or comments, please send an email to unitrap@crg.es