Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC1328
Clone ID GC1328
Cell line E14Tg2A.4
Vector pFLIP3
Project tigem
Note NULL

Sequence tag GC1328
Sequence
TAGAGGACACTACGGGATTTAGATGTTCTTTCTTTGGGAGCAGATGTCTTGCCAGAATATAAGCTGCAGACGCCACGCAT
CAACAAATTTACAATATTGCACTACAGTCCTTTCAAAGCAAAAAAAAAAAAAAAAAAGGGGGGGCCCGGGGATTTAGCCT
CCGGTATTCACCCCCTACTCTGCAGCATTTCTCCTCAATGACAGAGAGGAACAGAAAAGGCGAGAATGTGGCTATTCTTG
TAGCCCTTTGAATGTGGTAGACTTGATTGTGGATATTATGTTTATTATAGACATTCTAATAAACTTCAGAACAACCTATG
TAAAAAAAAAAAAAAAAAAAAGTAGCCCCCTGTTTTTTTACTT
Sequence Type mRNA
Unitrap ID UNI389

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 62625761..62626072 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059742 (Kcnh7) NM_133207 potassium voltage-gated channel, subfamily H (eag-related), member 7 Gene [Source:MGI (curated);Acc:Kcnh7-001]

 
Come back to gene ENSMUSG00000059742


For any suggestions or comments, please send an email to unitrap@crg.es