Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST308664
Clone ID OST308664
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST308664
Sequence
ACTGAGGATAAGGAAGCCTGTGTGGGTACCAACAATCAAAGCTACATCTGTGACACAGGACACTGCTGTGGACAGTCTCA
GTGCTGCAACTACTACTATGAACTCTGGTGGTTCTGGCTGGTGTGGACCGTCGTCATCATTCTGAGCTGCTGCTGTGTCT
GCCACCACCGCCGA
Sequence Type mRNA
Unitrap ID UNI22098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 46718841..46727028 106
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047731 (D19Wsu162e) NM_146099 Outcome predictor in acute leukemia 1 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q8BGW2]

 
Come back to gene ENSMUSG00000047731


For any suggestions or comments, please send an email to unitrap@crg.es