Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XS0095
Clone ID XS0095
Vector pGT0lxf
Project sanger

Sequence tag XS0095
Sequence
GTCTTTCCTGGGTGGGGTTTGTAAAGTCGTGGCCCGTTAGCAGGAAGCGGAGCAGTCGCCCAACGCTAGAGTGGGACCCA
ATCTGAGCACCCGGTTCTCCGGAGTCCTTGCCGAAGTGTACTGCGCGCTCAGAGCAGCCCGACAGTTTCCAGCCAAACTT
CACCAACTCCTCTGCCCTTGCCGCCACCATGCCGAAGACG
Sequence Type mRNA
Unitrap ID UNI4718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 93291384..93291582 199
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031207 (Msn) NP_034963 moesin Gene [Source:MGI (curated);Acc:Msn-001]

 
Come back to gene ENSMUSG00000031207


For any suggestions or comments, please send an email to unitrap@crg.es