Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST308087
Clone ID OST308087
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST308087
Sequence
GACTGAGCCCTCTCTTAGCCTGGCAAAAAATGACGGGTCTCGTAGCTGTTTGGGACGTAGCATTAAGTGACNGAGTCCAC
AAGATTGAATTTGAACATGGGACCACATCAGGCAAGCGGGTTGTGTACGTGGATGGGAAGGAAGAGATAAGANGAGAGTG
NATGTTCAGCNTGCNGGTCGTNNACACTGNTCTTTGTCGGAAGCATGCAAATACCAGAGNCACCATCCATATACATGCCA
TAAGTGGCTTCGCATACCAGTACACGCTGNANATTGATGGGANGAGCCTCNANAAGTACATGGAGANCAGGTCAAAGACC
ACCAGCACCTGGGTGCTGCGCCTGGATGGCCAGNACCTGAGAGTTGTTNTGGAAAAAGACACTATGGACGT
Sequence Type mRNA
Unitrap ID UNI22115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 98892518..98899404 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032463 (Faim) NM_011810 Fas apoptotic inhibitory molecule Gene [Source:MGI Symbol;Acc:MGI:1344387]

 
Come back to gene ENSMUSG00000032463


For any suggestions or comments, please send an email to unitrap@crg.es