Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR1129
Clone ID XR1129
Vector pGT0lxf
Project sanger

Sequence tag XR1129
Sequence
TTTTTAAAAGGGTTTTTTTTTTCTTTTTATCTTTCATTTTTTCAGGTGCCGCGTGGCCCGGTGTTGGCGTGACGGTTGGA
CGCGGGCGCGGCACTGCGGGTCCCGATTGCTGCAGCCGCTTGTCAGTGTGATGAAGATTGGCACCCAG
Sequence Type mRNA
Unitrap ID UNI4724

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31701731..31701833 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006705 (Pknox1) NM_016670 Pbx/knotted 1 homeobox Gene [Source:MGI Symbol;Acc:MGI:1201409]

 
Come back to gene ENSMUSG00000006705


For any suggestions or comments, please send an email to unitrap@crg.es