Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR1072
Clone ID XR1072
Vector pGT0lxf
Project sanger

Sequence tag XR1072
Sequence
ATGCTGGCGCTCATCTCCCGCCTGCTGGACTGGTTCCGTTCGCTCTTCTGGAAGGAGGAGATGGAACTGACGCTCGTGGG
GCTGCAGTACTCCGGCAAGACCACCTTCGTCAATGTCATCGCG
Sequence Type mRNA
Unitrap ID UNI4725

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 108733249..108733371 123
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030105 (Arl8b) NM_026011 ADP-ribosylation factor-like 8B Gene [Source:MGI Symbol;Acc:MGI:1914416]

 
Come back to gene ENSMUSG00000030105


For any suggestions or comments, please send an email to unitrap@crg.es