Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307780
Clone ID OST307780
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307780
Sequence
ACAGTGACCTATGATGATGTGCATGTGAACTTCACGTGGGAAGAGNGGGCTTTGCTGGATCCTTCTCANAAGANNNTCTA
CAGAGATGTGATGCTGGAGACCTACAGGAATCTCGCTGCTATAGGCTATGTTTGGGAAGACCATAATATGGAAGAGCATC
TTCATATTTCTAGAAGATATGGAAGGCATGAAAGAAGTCATACTGAACAGCTGCTCTCTGAGTTTATCCAANGNGATAAA
GCCTTNGCATTGCAGAGTCNTANCCAAAGACANGAAAGAATTTATACTGNAGAGCCCCCCTATGAANGNAACCANTGTGG
TAAATCCTTTGNGAGAAAGNGTCATNTCCTAANACAGACNANGANCACATACTGGAGAGAAACCACTTTT
Sequence Type mRNA
Unitrap ID UNI22126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150298959..150300613 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074731 (Zfp345) NP_001030072 zinc finger protein 345 Gene [Source:MGI (curated);Acc:Zfp345-001]

 
Come back to gene ENSMUSG00000074731


For any suggestions or comments, please send an email to unitrap@crg.es