Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307667
Clone ID OST307667
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307667
Sequence
CTGAGGGCCTAGTAATAACGCCACTGGTCAGTCCCGAGCCATGATTGCTGCAGCAGCTCGGCGCAGAGACTCCAGCCACA
ACGAGTTGTATTATGAAGAGGCCGAACACGAACGCAGGGTGAAGAAGCGGAGAGCAAGACTGGTAGTGGCTGTGGAGGAA
GCCTTCATCCATATCCAGCGTCTCCAGGCTGAGGAGCAGCAGAAGTCTCCTGGAGAGGTGATGGACCCCAGAGAGGCAGC
CCAGGCCATCTTCCCCTCCATGGCCAGGGCACTGCAGAAGTACCTGCGCACCACACGGCAGCAGCACTACCACAGCATGG
AGAGTATCCTGCAGCACCTGGCCTTCTGCATCACCAACAGCATGACCCCCAAGGTGCTCTGCTAGGTCGGGGCTGGGGCA
GAAAGGTCCCTGGGTTTGGCCGGTCACATGACATCCCATGTCTCCACTGTTGCTCACCACGTTATTTAAGACTTACTTTT
GATTTTGAATC
Sequence Type mRNA
Unitrap ID UNI17722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101967107..101969412 346
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027860 (Vangl1) NM_177545 vang-like 1 (van gogh, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2159344]

 
Come back to gene ENSMUSG00000027860


For any suggestions or comments, please send an email to unitrap@crg.es