Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307456
Clone ID OST307456
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307456
Sequence
TGTTGGTGAGGCCCCTGACCGGCNAGACCATCACCCTAGAGGTGNAGCCCAGTGACACCATCGAGAACGTGAAGGCCAAG
ATCCAGGATAAAGAGGGCATCCCCCCTGACCAGCAGAGGCTGATCTTTGCCGGCAAGCAGCCTGGAAGATGGCCGCACCC
TCTCTGATTACAACATCCAGAAGGAGTCAACCCTGCACCTGGTCCTTCGCCTGAGAGGNGGCATGCAGATCTTCGTGAAG
ACCCTGACCGGCAAGACCATCACCCTGGAGGTGGAGCCCAGTGACACCATCGAGAACGTGAAGGCCAAGATCCAGGATAA
AGAGGGCATCCCCCCTGACCAGCAGAGGCTGATCTTTGCCGGCAAGCAGCTGAAAGATGGCCGCACCCTNTCTGATTACA
ACATCCAGAA
Sequence Type mRNA
Unitrap ID UNI18917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62365657..62366063 388
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019505 (Ubb) NM_011664 ubiquitin B Gene [Source:MGI (curated);Acc:Ubb-001]

 
Come back to gene ENSMUSG00000019505


For any suggestions or comments, please send an email to unitrap@crg.es