Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307399
Clone ID OST307399
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307399
Sequence
TACGTTCATGGGGTAAGAANGCAGCANGGAGACATNGACATTAAAGTGGGAGCAAGCTGAATTCTCTGATCTCAATCTTG
TGGCTCATGCCAATGGTGGATNCTCTGTGGACATGGAAGTTCTTCGGAATGGAGTCAAAGTTGTGAGGTCTCTNAAGCCA
GACTTTGTGCTGATCCGCCAGCATGCCTTCAGCATGGCACTGTAATGGAGACTACCGAAGTTTGGTCATTGGGCTGCAGT
ATGCTGGAATCCCCAGTGTAAACTCTTTGCATTCTGTCTACAACTTCTGTGACAAACCCTGGGTGTTTGCCCAGATGGTT
CGACTACACAAGAAGCTTGGAACAGAGGAATTCCCTCTGATTGATCAGACTTTCTATCCTAATCACAAAGAGATGGGTCC
AAGAACTGNCTAAGAATGATACTCCCAGACTCAACTAGTATGCAAAAAAAAAACCCCAAAGAG
Sequence Type mRNA
Unitrap ID UNI22132

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20477021..20486698 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037217 (Syn1) NP_038708 synapsin I Gene [Source:MGI (curated);Acc:Syn1-001]

 
Come back to gene ENSMUSG00000037217


For any suggestions or comments, please send an email to unitrap@crg.es