Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307395
Clone ID OST307395
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307395
Sequence
TGAGGTGTCCAGCCCATACAGGTTCTAGCTCGGAAGAGGTTCGGGAATACCAGGNTGGCATTAAGGCTATGAACCTGGAC
CAAGTCTCCAAGGACAAAGCTCTCCAGAGCATGGCATCCATGTCGTCTGCCCAAATCTGTCTCTGCCAGCAGTTCTACAG
AACAAGTTCAGCCCGNCCTCCCCTCTACCCCAGGCTGTCTTCTCCTCCTCCTCAAGGNTNTGGANCAGCCCCCCTATNAT
AGGACAACAGNCTGGACCTTCTCAGGACATCAAGCCCTT
Sequence Type mRNA
Unitrap ID UNI22133

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 28471649..28473520 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002249 (Tead3) NP_035696 TEA domain family member 3 Gene [Source:MGI Symbol;Acc:MGI:109241]

 
Come back to gene ENSMUSG00000002249


For any suggestions or comments, please send an email to unitrap@crg.es