Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307203
Clone ID OST307203
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307203
Sequence
CCCCTTTGATCAGATCTACTACACACGATGTGCAGGACATCCTCAACTGGTTCAAGTGTACCCGGCACCGGATCAGCTAT
AAGACCGCGTATAGGCGCGGCCTCCGGACCATGTACCGGCGGAGGTCCCAATGCTGCCCTGGCCTACTATGAGAACGGAG
ACTTCTGCATTCCAG
Sequence Type mRNA
Unitrap ID UNI19628

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 64353868..64356615 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036466 (Megf11) NM_172522 multiple EGF-like-domains 11 Gene [Source:MGI (curated);Acc:Megf11-002]

 
Come back to gene ENSMUSG00000036466


For any suggestions or comments, please send an email to unitrap@crg.es