Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST307156
Clone ID OST307156
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST307156
Sequence
GAGAAATAGAAAACCAATAAATTATTCACAGTTTGAAGATTCTGGCAATGACTCTGATGATGATTTTATTTCTTCATCCA
CACCTGTAAACAAGTCAAAAACTGTGCCAAAGGTATTAAAGCAAGACAAACCAAAACCTAACGTTGAAGAATCTCCAAAA
AGAAGAGGTCTTACCAACAGAACCCCCTAAAAAAAGGGNGGCTNTAGATGACAAGGTCTTCCAAAGAGGNCNAGANGTTG
CCCTGGCTTTATCTGTGAAGGAACTTCCAACACTCACCAACCAAGTAAAGAAGTCCAAAGAGAAAAGCACTGACAAACAA
GGCAAAGAGAAAACAGAAAATACNGGGTAANCCTCCTCATGNCTCTAACTGCANAGTANCCAGTGATGATGTAGAATAT
Sequence Type mRNA
Unitrap ID UNI22141

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 126878159..126886028 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030346 (Rad51ap1) NM_009013 RAD51 associated protein 1 Gene [Source:MGI (curated);Acc:Rad51ap1-001]

 
Come back to gene ENSMUSG00000030346


For any suggestions or comments, please send an email to unitrap@crg.es