Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST306635
Clone ID OST306635
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST306635
Sequence
GACTGAGGCTGGTGAATTGGCTGNCTATAATGGGAAGAACCTACATTGTAGAAGAGACTGTTGGCCAGTATCTTTCAAGC
ATCAACCTCCAGGGAAAACCTTTTGTCTCTGGTCTTTTGATAGGACAGAGCACCATCCAAAGNGNANCTGAAGNGACATN
GTCAATACAGCCNCNAGCNAAGNGGAACAATTTGACATGAGT
Sequence Type mRNA
Unitrap ID UNI16062

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152237366..152237488 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006010 (BC003331) NM_145511 Protein odr-4 homolog (mODR-4) [Source:UniProtKB/Swiss-Prot;Acc:Q4PJX1]

 
Come back to gene ENSMUSG00000006010


For any suggestions or comments, please send an email to unitrap@crg.es