Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST303962
Clone ID OST303962
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST303962
Sequence
TGAGTGGTCTGAGCCCTGGATCCTTCAATCCCCGGGCATGGAACTCATTGCCTCCAGTGCAACAACAGCCTGGTGTATGG
AGCGAAGACATGCATGTAGGCCAGGGCCTTGTGGGACCCAGCAGCCTCATTCAACATAAAAGTATATTTTTGAAGTACCT
AAAGTATAATAACGTCACTATTATGCCAAAATTAAATAATCAGAATTTACAAAGAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22185

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11182493..11182702 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020193 (Zpbp) NM_015785 zona pellucida binding protein Gene [Source:MGI (curated);Acc:Zpbp-001]

 
Come back to gene ENSMUSG00000020193


For any suggestions or comments, please send an email to unitrap@crg.es