Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST303828
Clone ID OST303828
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST303828
Sequence
GGAACATTTCGAGGCGGCACTCAGGACCTATTTAAAGGCCTTCCTGNNCCCCCGAGATACANNNGNCAAAGGATGGTTCC
TNNTGGACAATTACATCCCTACGNTGGACTGTTNTGTNATTCACTTACTCATTGGATGGTNGGGACCAAAATACATGAAG
AACCGGGAGNCGTTCTNTTGCCGAGGNATCCTGCAGTTGTNTAACCTTGGACTCACCCTGCTGNCTNTNTACATGTTNTA
TGAGNNGNNGACAGGNGTGTGNNAAGGCAAATACAANTTTTTCTGCCAGGGAACACTGCAGNGCGGGAGAATCCGATATG
AAGATCATCCGCGTCCTCTGGTGGTACTACTTCTCCAAACTCATCGAATTCATGGACACCTTTTTCTTCATCCTTCGCAA
GAACAACCACCAGATCACCGTGCTCCATGTCTACCACCATGCTACCATGCTCAACATCTGGTGGTTTGTGATGAACTGGG
TTCCCTGCGGCCATTCATATTTTGGGGCGACACTTC
Sequence Type mRNA
Unitrap ID UNI22189

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 77804958..77824726 172
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032349 (Elovl5) NM_134255 ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI (curated);Acc:Elovl5-001]

 
Come back to gene ENSMUSG00000032349


For any suggestions or comments, please send an email to unitrap@crg.es