Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0472
Clone ID AX0472
Vector pGT0lxr
Project sanger

Sequence tag AX0472
Sequence
ATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGT
GAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTGGTTGTGAGCTCTTCTAGATGGTAGCCTCCAATGGAAGAA
CCCTTTTTAAACTCTTTCAGCATCCTTCCATGGCGATTGTGAAGGGAGCTGGATTGGTTATGAAGGCAATAATAGAG
Sequence Type mRNA
Unitrap ID UNI4747

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104120042..104120908 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054574 (AC145736.4-202) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q8BNL1]

 
Come back to gene ENSMUSG00000054574


For any suggestions or comments, please send an email to unitrap@crg.es