Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST303688
Clone ID OST303688
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST303688
Sequence
TGAGGGCTCTGGGTTTGCAGAGAGCCGAAATGACCATGACTGCCAACAAGAACTCCAGCATCACTCATGGAACCGGAGGC
ACTAAGGCCCCTCGGGAGACGCTGAGCAGGTGGGTAGAGGCATACTTCTGGGAGATGGCATCAAGAGCCAGTCAAATGGT
CTGGGACCCAGGTAGGATCTCCACCAAAGTATAAATAATTACCATGACTGCTGATCATCCTGTTTGCTTATTTGGGCCCA
GCTTGTGCTGATGATTAGGAGGAAGTCTTGTCTGACATACATAAAAATTCCCTATTTGGGATGGCAACTAGAAGCATTAA
GACAAGCTCT
Sequence Type mRNA
Unitrap ID UNI16126

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 116713300..116713627 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031024 (St5) NM_001001326 suppression of tumorigenicity 5 Gene [Source:MGI Symbol;Acc:MGI:108517]

 
Come back to gene ENSMUSG00000031024


For any suggestions or comments, please send an email to unitrap@crg.es