Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0358
Clone ID AX0358
Vector pGT0lxr
Project sanger

Sequence tag AX0358
Sequence
ATGAAGCATGCCTCATGACGTGTCCCACACAGAGGCGGATGACGATAGGATCTTGTATAATTTGATAGTCATTCGTAATC
AGCAGACCAAAGACTCAGAG
Sequence Type mRNA
Unitrap ID UNI371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 72238617..72238716 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039395 (Mreg) NM_001005423 melanoregulin Gene [Source:MGI Symbol;Acc:MGI:2151839]

 
Come back to gene ENSMUSG00000039395


For any suggestions or comments, please send an email to unitrap@crg.es