Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST303578
Clone ID OST303578
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST303578
Sequence
GGCCCTGTTATCTGCGCTTCCCAAAAATTTCATNCAGAGCGTCCGAAATAAANGGAAGAGGANGGCAAGTGACGATGGCN
GGAGACTCCCCCGAGCACGATGCCGACATCCCTGAGGTTGATCCTGTTCCAGCGTGCAGGTGAACACNGCGTCCGACGTT
ACAAACGGNACTATAAGCTGCAGACCAGACCAGGCTTCAACAAGGCCCAGCTAGCAGAGACTGTGAGCCGACACTTCAGG
AACATACCAGTGAATGAGAAAGAGACGCTTGCCTATTTCATCTACATGGTGAAGAGTAACAGGAGCAGACTGGACCAGAA
GTCAGAGGGCAGCAAGCAGCTTGAGTGAGCTACAGCCACCTGCCCGTGTGAGGTGGGGGCCGTGATGAAAGGACAGCCGG
GTACTGCTTGATGACAGGTGGCCTCTGCAACATCTCAGCCAATAAGGACTGTTCATATCTACTGTAAATAAAGTTTGAAT
GATGGATACTGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 57619554..57623719 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020519 (Sap30l) NM_001081168 SAP30-like Gene [Source:MGI (curated);Acc:Sap30l-001]

 
Come back to gene ENSMUSG00000020519


For any suggestions or comments, please send an email to unitrap@crg.es