Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0254
Clone ID AX0254
Vector pGT0lxr
Project sanger

Sequence tag AX0254
Sequence
CTTGGCCTCTTTCAGAAATCTCGATCAGAGGACTGTCGAGGGCGACCTTTGATTGACAGAAAGAGGAAGTTTGTGGACAC
AGATCTGGCTCACGATTCTGAAGAGTTGTTTCAGGATCTTAGCCAGCTGCAGGAGGCTTGGTTAGCTGAAGCACAAGTTC
CTGATGATGAGCAGTTTGTCCCAGATTTTCAGTCTGATAACT
Sequence Type mRNA
Unitrap ID UNI4752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22436083..22436376 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es