Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AX0189
Clone ID AX0189
Vector pGT0lxr
Project sanger

Sequence tag AX0189
Sequence
TTAGACGCGATTGCTTGAGATGAACCTTATGCACGCACCTCAA
Sequence Type mRNA
Unitrap ID UNI4754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86533752..86533792 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es