Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST303248
Clone ID OST303248
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST303248
Sequence
GAGGTCCTGCTTAGGATGAATGTGATTTGGAGAAGNTGCATTTGCCGACTGAGGCAGGGGAAGGTACCACACCGATGCCA
GAGTGGCGTCCACCCGGTAGCCCCTCTGGGGTCGAGGATTTTAACTGACCCCGCCAAAGTTTTTGAACACAACATGTGGG
ATCACATGCAGNGGTCTAAAGAAGAAGAAGACGCAGCTAGAAAAAAGGTAGAGGAAAACTCAGCCACACGAGTCGCTCCA
GAAGAGCAAGGTAAGGCTGGCATNCTGTCCCAGCATTNGGAAGTTNTGNGCTGCCACCCCAGCCAGTCAACCCATTTGCT
ACCTTTGGTGGGATTCCCAGTTCTTCCCTTGTAGTGNNACCGAAATTAATGAAATAAATTATGTATTCACCCTGTAAAAA
AAAAAA
Sequence Type mRNA
Unitrap ID UNI14175

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 70831394..70856433 226
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041975 (Mettl8) NP_663499 methyltransferase like 8 Gene [Source:MGI (curated);Acc:Mettl8-002]

 
Come back to gene ENSMUSG00000041975


For any suggestions or comments, please send an email to unitrap@crg.es