Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0664
Clone ID AW0664
Vector pGT0lxr
Project sanger

Sequence tag AW0664
Sequence
CGAAACAAGATGGCGGCGCCCAGTGGAGTCGAGGCCGCGCTCGGGGTTTGCCGAGGCTGACTTTCCGTCCCGCTCTCCCT
TTGGGTGCCACTCGCCGCGAGCGGGAGGACAGGGGCCGGGCGGGGACAGGGGCACTTGCGTGGCTGGAATTCATGGGAAG
AGGAACCGAAA
Sequence Type mRNA
Unitrap ID UNI4767

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43921436..43921581 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053128 (Rnf26) NM_153762 ring finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:2388131]

 
Come back to gene ENSMUSG00000053128


For any suggestions or comments, please send an email to unitrap@crg.es