Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST302765
Clone ID OST302765
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST302765
Sequence
ACTGAGCTGGAAGGAAATGNGGCTACAAGGATTATTGGCAAGGTCTCTATCAGGGGGAAGCTCTCACTGCCATGATCCAC
AACAATGAGACACAGCAGAGGAAATTTTGGGATTATGTACATGAGATCTTCATGAAACGGAATAAAAATCTCTAACTGCC
TTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22235

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 21517431..21517589 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039357 (Fut11) NM_028428 fucosyltransferase 11 Gene [Source:MGI Symbol;Acc:MGI:1920318]

 
Come back to gene ENSMUSG00000039357


For any suggestions or comments, please send an email to unitrap@crg.es