Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0632
Clone ID AW0632
Vector pGT0lxr
Project sanger

Sequence tag AW0632
Sequence
GCCGGAGGAGCTGCAGGAGGAGGAGGGGCAGGAGGATGTCAATGAGAAAAAG
Sequence Type mRNA
Unitrap ID UNI4768

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93384386..93384437 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es