Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST302705
Clone ID OST302705
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST302705
Sequence
AATCGGGAGCGGTGCCGAGAAAATTTCCTTACTAGATGACATTTCATCGCAATGTCCGATCGTTTGGGGCAAATAACCCA
GGGCAAGGATGGGAAAAGCAAGTACTCGACTCTCAGCCTGTTTGACAAGTATAAAGGGAGGTCAGTAGGCGCCTGTCAGG
TCCTCAGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 32037981..32038146 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039262 (5830434P21Rik) NM_172661 RIKEN cDNA 5830434P21 gene Gene [Source:MGI Symbol;Acc:MGI:1923304]

 
Come back to gene ENSMUSG00000039262


For any suggestions or comments, please send an email to unitrap@crg.es