Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0602
Clone ID AW0602
Vector pGT0lxr
Project sanger

Sequence tag AW0602
Sequence
GTTTTTTTAAAGGGTTTTTTTTTTTTTTTAAGGCATCTCAAGAAGGAATGACAGCATGGACGGAAGAGGAGTGCCGAAGC
TTTGAACATGCACTGATGCTTCAAGGAAAAGATTTTCATCTCATTCAGAAAGATAAGGTCCCATACGG
Sequence Type mRNA
Unitrap ID UNI4772

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112501887..112501990 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032727 (Mier3) NP_766181 mesoderm induction early response 1, family member 3 Gene [Source:MGI (curated);Acc:Mier3-001]

 
Come back to gene ENSMUSG00000032727


For any suggestions or comments, please send an email to unitrap@crg.es