Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST302501
Clone ID OST302501
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST302501
Sequence
GACGTGTGTTCTTGGGCAGGGTCTGAGGTTTTGGAACCTCTTTCTAAAAGGGACAGAAAGAGCACCCTGCTACATTTGCT
AATCCAGAGGCTGAGTGGAGCCGAGCTGGTCAGGATGCAGGTTCCCGTCGGCAGCAGGCTTGTCCTGGCTCTCGCCTTCG
TCCTGGTTTGGGGATCTTCAGTGCAAGGTTATCCTGCTCGGAGAGCCAGGTACCAGTGGGTCCGCTGCAAACCGAATGGC
TTTTTTGCGAACTGCATCGAGGAGAAGGGACCACAGTTTGACCTAATAGATGAATCCAATAACATCGGCCCTCCCATGAA
TAATCCTGTTTTGATGGAAGGACCCTCAAAAGATTTCATCTCCAATTATGATGACTATGGGTCAGGTTCGGGCTCCGGCT
CTGGCTCCGGCTCTGGCTCGGGTTCCGGCTCCGGAAGTGGCTTCCTAGGTGACATGGAATGGGAATACCAGCCAACAGAT
GTCATGTA
Sequence Type mRNA
Unitrap ID UNI22246

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 61957706..61970576 189
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020077 (Srgn) NM_011157 serglycin Gene [Source:MGI (curated);Acc:Srgn]

 
Come back to gene ENSMUSG00000020077


For any suggestions or comments, please send an email to unitrap@crg.es