Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST302417
Clone ID OST302417
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST302417
Sequence
AGGCGAGGGGAGAGANTGCCAACTGGNCCGAGCTTCCCAGNTCCTACCTTGCNTGTNTTNTGTCTNCTGGNAANANGTTN
CTGGGGNNGCTTGACCGGTAGGCATCTNCCTCAGGCAAGAGCTCNGNCATCCAGGNATTCGCAACAGGCTGGTCATGTGC
TGAAATCNACGTGGACAGTCATTGCGCNGGCACGTTGTCCAGCCAGGGTATCCTGCCCACCGGCGTATAGTAGAGGCCTT
TGGCACTGAAGTCTTGCTGGAGAATGGCGACATCGACCGCAAGGTCCTCGGAGACCTGATCTTCAACCAGCCTGACCGTC
GGCAGCTGCTCAACTCCATTACCCACCCTGAGATCCGCAAGGAAATGATGAAGGAGACCTTCAAGTACTTTCTCCGAGGC
TACCGATACGTGATTCTGGACATCCCCCTCCTGTTTGAGACCAAGAAGCTGCTCAAGTATATGAAGCACACAGNGGTAGT
GTACTGTGACCGTGATACACAGCTGGCGCG
Sequence Type mRNA
Unitrap ID UNI19400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102858642..102861649 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020935 (Dcakd) NM_026551 dephospho-CoA kinase domain containing Gene [Source:MGI (curated);Acc:Dcakd-001]

 
Come back to gene ENSMUSG00000020935


For any suggestions or comments, please send an email to unitrap@crg.es