Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0556
Clone ID AW0556
Vector pGT0lxr
Project sanger

Sequence tag AW0556
Sequence
GCGTCCTTTCCCCGGCACCGCCCCGCCCGATCCCGGATTCCGCCTGGAGCTCGCTGCTGCCTGATAGAAACGCCAGGGAG
CCAAGATGGCAGCTGCCGACGGTGACGATTCGCTCTATCCTATTGCGGTGCTCATAGATGAACTCCGCAATGAGGACGTT
CAG
Sequence Type mRNA
Unitrap ID UNI4777

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21082385..21082547 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007564 (Ppp2r1a) NM_016891 protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform Gene [Source:MGI (curated);Acc:Ppp2r1a-001]

 
Come back to gene ENSMUSG00000007564


For any suggestions or comments, please send an email to unitrap@crg.es