Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST302125
Clone ID OST302125
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST302125
Sequence
GTTTGAGGAGCCACCTGTGNGCCTTCTCCTAAGAGCCCCAGGGGNAGACCCAAAGGCAGCAAAANCAAGAGCCCCTCTAA
AGCAGCCCAGAAGAAAGCAGAGACCATTGGAGAAAAACGGCCAAGAGGCAGACCTAGGAAATGGCCACAACAAGTCGTTC
AGAAGAAGCCTGCTCAGGTAAGACACGCCCCCTTGTGATTATTCTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 119811684..119910396 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056758 (Hmga2) NM_010441 high mobility group AT-hook 2 Gene [Source:MGI Symbol;Acc:MGI:101761]

 
Come back to gene ENSMUSG00000056758


For any suggestions or comments, please send an email to unitrap@crg.es