Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST302006
Clone ID OST302006
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST302006
Sequence
TCTGAGGCAGGTGTTTGCGGATCNNTGCCCCCTGGNAAGTGAGTCATAGGCATTGTTCAAGAAGGAAGCAGCTAAGACAA
CATGAATGAACAAAAAATGAATGAACAAATGAAGAAAACCGGCAAAGACAAGTGGCCAGAAAGGGCCGGGCGGAAGAGCC
CTCGACAGACTGACCCTAAAGCAAGACGAGGCAAGGCCAGTCCAGAATACCAGAGTGGAAGCTCCCCGTGTAACATACAC
CATCCGGGATGAAAGTGAGATTAGCCCCGAGACTGAGGAAGATGGCTTCCCTGACGGATACCTAGAGTGCATCATACGAG
GTGAGTTTTCCGAACCCATTCTGGAAGAGGATTTCCTTTTTAAATCCTTCGAAAGCTTGGAGGAAGTGGAGCAAAACCTT
TCTCGCCAGGTTCTGGAAGCGAGTTCCCTTCTCGAGTCTTCTTTGGAGTACATGACAAAGGGGACGAAGCAAGAGAAGAC
AGAGGTCACGCAAGAGACCCCTCCGCTGAGGGTTGGGGCGAGCTCATTACTGCCTT
Sequence Type mRNA
Unitrap ID UNI304

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44381368..44381896 513
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es