Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST301994
Clone ID OST301994
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST301994
Sequence
GGTTGTCCTACATGCGGGTGAAGTATCTTTTCTTTTNCTGGNTGGTGGTTTNTGTCGGAAGCTGGATCATATATGNGCAG
TATTCAACCTATACAGAGCTATGCANAGGGAAGGACTGTAAGAAAATCATATGTGACAAATACANGACCGGAGTTATTGA
CGGACCTGCATGCAACAGCCTCTGTGTCACAGAANCACTGTACTTTGGAAAATGTCTGTCCAACAAGCCCAGCANCCAGA
TGTATTTAGGAGTTTGGGATAATCTACCAGGTGTTGTGAAGTGTCAAATGGAACAAGCTCTTCATCTTGATTTTGGAACT
GAATTGGAGCCAAGAAAAGAAATAGTGCTATTTGATAAACCAACCANGGGAACTACTGTACANAAATTCAAAGAAATGGT
GTACAGTCTCTTTAAGGCAAAATTAGGTGACCAAGGGAACCTCTCTGAATTGGTATAATCTCATCTTGACAGTGGCTGAC
GGAGACAGAGATGGCCAGGTCTNCCTTAGGAGAAGCCAAGTCCC
Sequence Type mRNA
Unitrap ID UNI15792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108339132..108353734 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029270 (2900024C23Rik) NM_026062 RIKEN cDNA 2900024C23 gene Gene [Source:MGI Symbol;Acc:MGI:1914516]

 
Come back to gene ENSMUSG00000029270


For any suggestions or comments, please send an email to unitrap@crg.es