Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST301933
Clone ID OST301933
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST301933
Sequence
GACTGAGACTTTCTGCCTGGCTAATCAAGAGTGAAAAACCTGAAGAGATGCAGGCAGGAAAACGGAATTAAACTAGGCCT
GAGAAGCGATGAGACAGGCATGATGGAAGTCGAGTCCTCCTACTCGGACTTCATCTCCTGCGATCGGACAGGCCGTCGGA
ATGCAGTCCCTGACATCCAGGGTGACTCGGAGGCCGTGAGTGTGCCGGAAGCTTGCTGGAGACATGGGCGAGCTCGCACT
TGAGGGAGCAGAAGCACAGGCAGAGGGCAGTACCCCCGACAAGGAGGCCAGCAGCCAGCCTGAGAGCAATGATGCGAACA
CCTCGTCCTGAGTCTGCCTGTGGTCCCAAGGCTGGAAGAGACCTGCTGTACCTCCCGGACTGGAGCCCTGGCCAGCCAGG
CGGACTGAGAGCCTCATGGAGTCCTCTGTGGCCTCCCCTCCAGCCAAGTCCTCCACCCACAGCACAGGCTCCACCCTTCC
CCACCTCCCCACGGTGCCCAGGTTCACTCTGAAGACACCAGC
Sequence Type mRNA
Unitrap ID UNI22267

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163529217..163551463 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035268 (Pkig) NM_001039390 protein kinase inhibitor, gamma Gene [Source:MGI (curated);Acc:Pkig-001]

 
Come back to gene ENSMUSG00000035268


For any suggestions or comments, please send an email to unitrap@crg.es