Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST301705
Clone ID OST301705
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST301705
Sequence
TATTGTCACATCGATGACCGCTGGTGTCTCCGAGAGAGAGGCCAATGATGCTCTCAATGCCTATGTGTGCNAAGGACCTC
CCCAGCATGAGGAGATCTGCCTAGGCCTGTTTACTCTNGACCTCACTGAGCCTGCCNAAGCCCAGAAGTGATACCGNGAC
TTGGCTCTGGNGAGTCGAGATGGTNTAAACATCGACNTNAACAANATGANCCNGCTACTNATGGNNAAGNACTTGAANCT
GCACAGATACCTGCCNTACATCANTTGGNGTGNTTGATTCGGCAACTATTTTAAGAGTGGAGTTCTGACAGCCTGNTGGC
GTTTGCNTGACATTNATGAAGCANATTGCANGTGGCGATGTTACAGCCAAAAATATCTGGTTGGCAGAAAGTGTCCTGGA
TATCCTGACGGAACANAGGGAGTGGGTGCTTGAAGANCAGCATACTCATTGCCATGGCTGTGTACACGTACCTCCGACTT
ATTGTGGACCACCATGGGACTGCCCA
Sequence Type mRNA
Unitrap ID UNI22280

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 90215181..90225755 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027933 (Ints3) NM_145540 integrator complex subunit 3 Gene [Source:MGI Symbol;Acc:MGI:2140050]

 
Come back to gene ENSMUSG00000027933


For any suggestions or comments, please send an email to unitrap@crg.es