Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST301696
Clone ID OST301696
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST301696
Sequence
TCGGCCCTTTGTGGAGGTGCTAGTGGGCAGCTCGGCTGGAGGGGCCACAGCTGGTGAACAGGACTATGAGGTCCTTCTGG
TCACCTCCTCTTTCATGTCCCCCTCTGAGAGCCGAAGTGGCTCAAATCCCAACCGTGTTCGCATTTTTGGACCTGACAAG
TTAGTCCGGGCAGCNNGCCGGAGAAGCCGCTGGGACCCGTGTTAAAATTGTGTGCAGCCAGCCATACAGCAAGGACTCGC
CATACGGCCTGAGTTTTGTGAAGTTTCACAGCCCTCCTGACAAAGATGAGGCAGAGGCTACATCTCAGAAGGNGACNGTG
ACCAAGCTNGACCAGTTTNGTGTGAAAGANGAGGATGACAGTGCCAACTCCCTGAAGCCAGGGGCTTCTCTTCTTNAGTC
NTANGAACAAGACTTCATCAGCCNTCTACNAGTGACCCAGNAAGACCNAGCTATGCACCANCCTACNCTGCAGGCCTGTA
GTGCAG
Sequence Type mRNA
Unitrap ID UNI2839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25344803..25351519 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051768 (Xrcc1) NM_009532 X-ray repair complementing defective repair in Chinese hamster cells 1 Gene [Source:MGI Symbol;Acc:MGI:99137]

 
Come back to gene ENSMUSG00000051768


For any suggestions or comments, please send an email to unitrap@crg.es