Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AW0174
Clone ID AW0174
Vector pGT0lxr
Project sanger

Sequence tag AW0174
Sequence
TTTTTAAAGGGGTTTTTTTTTTTTTAAGAGATGCTGCTACAGATCGCTGATGATTTTATTGAGAGTGTGGTGACAGCTGC
CTGCCAGCTTGCTCGGCACCGCAAGTCCAGCACCCTAGAGGTAAAAGACGTCCAGCTGCATCTAGAGCGCCAGTGGAACA
TGTGGATCCCAGGCTTTGGCTCTGAGGAAATCCGACCCTACAAAAAAGCCATGTACCACAGAGGCTCACAAACAG
Sequence Type mRNA
Unitrap ID UNI4783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131845228..131847866 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es