Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST301663
Clone ID OST301663
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST301663
Sequence
CAGACCTTTCTCCAGGGCAAATGAGGGCAAAAAGGGTCNNTTCATANAAGATCTTATNACCAAATGGCAAAAGAATGATC
AAGAGTTCATCTCTGATTCCTTTCAACAGTGCTTGAGAAAAGATGAAATTTTAGATGGACAGAGATCAGTGGACCAGCTA
AAGCGGAGTAGGAGGAAAGGACGAAACAAACAGGAAGTTCCTGCATTTCCTGAACCTGACGTAGCTGTGGAGGTCAAAAC
ACCTTTAGATTTGGCTAAGGCACAAGAAAGCAACAACTCCGTAAAGAAGAAGACAAGATTTGTCAATTTATATACAAGAG
AGGGACAGGACAAACTTGCAGTCCTGCTTCCTGGTCGTCACCCGTGTGATTGCCTGGGCCAGAAGCACAAACTCATCAAT
AACTGTCTGGTCTGTGGGCGGATCGTTTGTGAGCAGCA
Sequence Type mRNA
Unitrap ID UNI9268

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65722674..65728820 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es