Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST301228
Clone ID OST301228
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST301228
Sequence
AGAAGAACTTATCCAGGGGCGTGCTGGCCCAGGTGGCGGAACAATTTTCCAGAGCGTTTAAGATCAACGAGCTGAAAGCC
GAAGTTGCAAATCACCTGGCCGTGCTGGAGAAACGGGTGGAATTGGAAGGACTTAAAGTGGTGGAGATCGAAAAATGCAA
GAGTGACATTAAAAAGATGCGGGAGGAGTTGGCAGCTAGGAACAGCAGGACCAACTGTCCATGTAAATACAGTTTTTTGG
ATAACAAGAAGTTGACACCTCGACGTGATGTCCCCACTTACCCCAAGTACCTGCTCTCCCCAGAGACCATCGAAGCCCTA
CGGAAGCCCACCTTTGATGTCTGGCTTTGGGAACCCAACGAGATGCTGAGCTGTTTAGAACATATGTACCACGACCTTGN
TCTGGTCAGGGACTTCAGCATCAACCCAATCACGCTCCGCAGGTGGCTGCTCTGTGTGCATGACAACTACAGGAACAACC
CCTTTCACAACTTTCG
Sequence Type mRNA
Unitrap ID UNI22302

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 31580115..31596892 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041119 (Pde9a) NM_008804 phosphodiesterase 9A Gene [Source:MGI Symbol;Acc:MGI:1277179]

 
Come back to gene ENSMUSG00000041119


For any suggestions or comments, please send an email to unitrap@crg.es