Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST300898
Clone ID OST300898
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST300898
Sequence
GACTGAGCCCGAGCCCCCTGGAAATTCTCATCCCTGACTTTGTTAAACAGACCTCTGAGGAGAAGCCTAAAGACAGTGAA
GAACTGGAGTATTTTAACCACATCAGTNTTGAGGATTCACGGAGTCTATGAGCTGNCAAGCAAGGCTGGGCNTGTTGTCT
CCATATNAGATCCTCCATGAGTGCCTTAAAAGAAACCATGGAATGGGTGACACATCCATCAAGTTTGAAGTGGTTCCTGG
GAAAAACCANAAGAGNGAATATGTTATGGCATGCGNCAAACACACAGTGCGCGGGTGGTGTAAGAATNTGNNTTCTNCCN
TGCNTCCNTAATANACNGGCATGCTTTNAGAGGACTGCTAGGATATGNATAGCNTTTTNTGNTNTGAGGNCTTGGTCTGC
TACTACTGTTCTAACANTCNTTNTAAGCNCANNTTTTGTGTGTTGGCCATNACACCTTCATNTGAAACTAGATAGGCGGN
TATCCTCCTTACATNCTCCCTCCTGTTCCATG
Sequence Type mRNA
Unitrap ID UNI9380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18259430..18272898 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]

 
Come back to gene ENSMUSG00000022718


For any suggestions or comments, please send an email to unitrap@crg.es