Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST300559
Clone ID OST300559
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST300559
Sequence
TGAGAAAATGTGCTGTCTGCACAGCTTCTGTCTATCCACCAGGTCTTCAGACAGATGGACCCTTGCCTGCCTTGGTCCTT
AAAGGTGTACATTAAATGTCTTTCACAGAGAGTTAAGATCTGTGGCTTTGAACCTGCATTGTGTAGCTGCCTTGATTTTA
ATCAAGCTTTATCTGTGAGTGTTCAGACCAACNTGATCACATTGATCAGAATAAAAACCAAATGCTTTGTAGTTTGATGT
GTATGAGTCCCTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22315

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54511563..54511817 252
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037533 (Rapgef6) NM_175258 Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Rapgef6-003]

 
Come back to gene ENSMUSG00000037533


For any suggestions or comments, please send an email to unitrap@crg.es