Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST300507
Clone ID OST300507
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST300507
Sequence
TTCATGATACAGTTGTAGCTGTTTTCAACAAAGCTCGGTGATGAAAACTGTTATTTTTAACAAGATACCTCCAAGTTAAA
CATGAAACGAAAACACTTGGATCGTTTCCGTTCTGGCAAGGCAAAGAATACAGCGTTTTCCAGCTAACTGGTCATGGCAC
CTCTCTAAGAGTGACTCGTCATGCACCCCACCGGGAACATGGATGTTGGCTTTACACGGTCTGCTGTTCAGACCTTGTCC
AGGAGCCACTGCAAAAACATCAAACAGAAGATTTCCCAGTGGGAAGGAAGAGCTAACGGTGTAACCAAGACAGCTAAGTT
TCACCCAAAGGACTTTGGAGTGAGGTATAACTGCCACCAAGAGAGTCCCCCTCATAAGCGTCCCACTGGTGAGGAAAGGA
ATGGGGCTTTACCCAGAAACACGGATGTCAAAAGCCGAGATCAAAGTGAGGATGAAGGCGAGGGTGGAGAGTGTAGAGGC
TCCCAGCT
Sequence Type mRNA
Unitrap ID UNI14457

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 102935281..102935765 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007379 (Dennd2c) NM_177857 DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

 
Come back to gene ENSMUSG00000007379


For any suggestions or comments, please send an email to unitrap@crg.es